ankle2

Ensembl ID:
ENSDARG00000035607
ZFIN ID:
ZDB-GENE-030131-6090
Description:
ankyrin repeat and LEM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001119867]
Human Orthologue:
ANKLE2
Human Description:
ankyrin repeat and LEM domain containing 2 [Source:HGNC Symbol;Acc:29101]
Mouse Orthologue:
Ankle2
Mouse Description:
ankyrin repeat and LEM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261856]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5287 Nonsense Mutation detected in F1 DNA During 2016
sa26430 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40384 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Nonsense 123 961 2 13
ENSDART00000142531 Nonsense 123 206 2 3
ENSDART00000145210 Nonsense 123 961 2 13
Genomic Location:
Chromosome 5 (position 20739890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGCGCCTGTAAWGTGGAGAACACGCAGACTCCCTCTAAAACTGCA[C/T]AGGTGTCACCCACCTTCTACGGAGTGTGTCCATTGTGGGAGGATGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Essential Splice Site 400 961 7 13
ENSDART00000142531   None 206 None 3
ENSDART00000145210 Essential Splice Site 400 961 7 13
Genomic Location:
Chromosome 5 (position 20732307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGGTAAAGTTCAAGAAGTCAAACAGAAAATAAATGAATATTTAGAAG[G/A]TAAGCTGATGATATTACTTGTTGTATTTAATTTAACATGTTGATCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Nonsense 776 961 11 13
ENSDART00000142531   None 206 None 3
ENSDART00000145210 Nonsense 776 961 11 13
Genomic Location:
Chromosome 5 (position 20730560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGATGAGTACTTTCTGGCCAGTGAGCGGCTGGAACCTATAAACCAA[C/T]AGACTATAGATACTTCAGGGTGCGAGCGCATGATCTGCGCCAGGTCAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link