ankle2

Ensembl ID:
ENSDARG00000035607
ZFIN ID:
ZDB-GENE-030131-6090
Description:
ankyrin repeat and LEM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001119867]
Human Orthologue:
ANKLE2
Human Description:
ankyrin repeat and LEM domain containing 2 [Source:HGNC Symbol;Acc:29101]
Mouse Orthologue:
Ankle2
Mouse Description:
ankyrin repeat and LEM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261856]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5287 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Nonsense 123 961 2 13
ENSDART00000142531 Nonsense 123 206 2 3
ENSDART00000145210 Nonsense 123 961 2 13
Genomic Location:
Chromosome 5 (position 20739890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGCGCCTGTAAWGTGGAGAACACGCAGACTCCCTCTAAAACTGCA[C/T]AGGTGTCACCCACCTTCTACGGAGTGTGTCCATTGTGGGAGGATGTGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zqspfmlk