tchp

Ensembl ID:
ENSDARG00000035605
ZFIN ID:
ZDB-GENE-060421-3368
Description:
Trichoplein keratin filament-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q1RM03]
Human Orthologue:
TCHP
Human Description:
trichoplein, keratin filament binding [Source:HGNC Symbol;Acc:28135]
Mouse Orthologue:
Tchp
Mouse Description:
trichoplein, keratin filament binding Gene [Source:MGI Symbol;Acc:MGI:1925082]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Nonsense 480 499 11 12
Genomic Location:
Chromosome 5 (position 21662134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGGAGGAGCTTAGGCTCCAGGAGGAGGAACTTCGTCTTGAGACGGAC[C/T]GAATGATTCGACAGGGCTTYCAGGAGAGAGTGAGTGGAGATTAAKGTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oyczxkxl