tchp

Ensembl ID:
ENSDARG00000035605
ZFIN ID:
ZDB-GENE-060421-3368
Description:
Trichoplein keratin filament-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q1RM03]
Human Orthologue:
TCHP
Human Description:
trichoplein, keratin filament binding [Source:HGNC Symbol;Acc:28135]
Mouse Orthologue:
Tchp
Mouse Description:
trichoplein, keratin filament binding Gene [Source:MGI Symbol;Acc:MGI:1925082]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31424 Splice Site, Nonsense Available for shipment Available now
sa26437 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33566 Essential Splice Site Available for shipment Available now
sa14422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Splice Site, Nonsense 176 499 4 12
Genomic Location (Zv9):
Chromosome 5 (position 21655373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19368245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGATCACATTGTGAGTCAGTGGCAGGTTCAACAGCAAGAGAAAAAA[C/T]AGGTAAGACATGTTAAATGTCGGCACAAGCATGAATGCAACTCGGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Essential Splice Site 272 499 6 12
Genomic Location (Zv9):
Chromosome 5 (position 21656396)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19369268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGAGAGGAAGATGATGGAGGAAAGCAGAAGGAAAACGGAATTTGGG[T/C]GAAAAATTTAGACTTAAATATTGTATGTGTTAAGGGATTTATTTCTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Essential Splice Site 380 499 10 12
Genomic Location (Zv9):
Chromosome 5 (position 21659265)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19372137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAATGTAGTCAAATTTGTGACCGTTAGTTTGTGTGATATTTTTTGTC[A/G]GGTCCTGGCAGGTCGTCAGCAGCAGTTGCAGGAGCGAATGCAGGAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Nonsense 480 499 11 12
Genomic Location (Zv9):
Chromosome 5 (position 21662134)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19375006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGGAGGAGCTTAGGCTCCAGGAGGAGGAACTTCGTCTTGAGACGGAC[C/T]GAATGATTCGACAGGGCTTYCAGGAGAGAGTGAGTGGAGATTAAKGTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link