dao.2

Ensembl ID:
ENSDARG00000035603
ZFIN ID:
ZDB-GENE-040426-2634
Description:
D-amino acid oxidase [Source:RefSeq peptide;Acc:NP_999897]
Human Orthologue:
DAO
Human Description:
D-amino-acid oxidase [Source:HGNC Symbol;Acc:2671]
Mouse Orthologue:
Dao
Mouse Description:
D-amino acid oxidase Gene [Source:MGI Symbol;Acc:MGI:94859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20378 Nonsense Available for shipment Available now
sa40392 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051612 Nonsense 151 348 6 11
Genomic Location (Zv9):
Chromosome 5 (position 21961344)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19674216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTAACACAGTCTTTGACACTTTGTTCACATTGATGTGCTTTTCTGCAG[G/A]TTAAAGCAAAGAGGCGTCGCATTTTTTCAGAGGACGATTGACTCATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051612 Essential Splice Site 232 348 8 11
Genomic Location (Zv9):
Chromosome 5 (position 21958751)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19671623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATGATTCCACATCAGGAGTCTATGATTCACCGTACATCATTCCTGGG[T/C]AGATCTCCTTAATAAATTTATCAAATAAAAATTCATTGATAAAATGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link