coro1ca

Ensembl ID:
ENSDARG00000035598
ZFIN ID:
ZDB-GENE-030114-6
Description:
coronin, actin binding protein, 1Ca [Source:RefSeq peptide;Acc:NP_958452]
Human Orthologue:
CORO1C
Human Description:
coronin, actin binding protein, 1C [Source:HGNC Symbol;Acc:2254]
Mouse Orthologue:
Coro1c
Mouse Description:
coronin, actin binding protein 1C Gene [Source:MGI Symbol;Acc:MGI:1345964]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16635 Essential Splice Site Available for shipment Available now
sa11685 Essential Splice Site Available for shipment Available now
sa11512 Nonsense Available for shipment Available now
sa14944 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004217 Essential Splice Site None 474 1 11
Genomic Location:
Chromosome 5 (position 22102997)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAATTAAAGTCGGGCTTGGATATATTTTGCCTACGACAGCTGAGAAG[G/A]KAAGGATAAGGACAWACTCTCTCTGAAGCGTAATGTTTGCAGAAYGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004217 Essential Splice Site None 474 1 11
Genomic Location:
Chromosome 5 (position 22102998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAATTAAAGTCGGGCTTGGATATATTTTGCCTACGACAGCTGAGAAGG[T/G]AAGGATAAGGACAWACTCTCTCTGAAGCGTAATGTTTGCAGAAYGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004217 Nonsense 7 474 2 11
Genomic Location:
Chromosome 5 (position 22149799)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAKCATTCTTGTCTTGTTTTCSTTTGCAGATATGTTCAAACGGGTTGTA[C/T]GACAGAGTAAGTTCCGGCATGTGTTCGGCCAGGCGGTGAAGAATGACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004217 Essential Splice Site 151 474 4 11
Genomic Location:
Chromosome 5 (position 22183567)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTTGTYACCTGGCATCCWACTGCACGCAACGTCCTCCTCAGTGCAGG[T/A]AWGAAAGGTTTCGGCAATCATCNNNNNTAGATGCCCTAATCAATGCCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lopg8jmi