si:dkey-174n20.1

Ensembl ID:
ENSDARG00000035579
ZFIN ID:
ZDB-GENE-030131-7890
Description:
hypothetical protein LOC796174 [Source:RefSeq peptide;Acc:NP_001076385]
Human Orthologue:
DHRS13
Human Description:
dehydrogenase/reductase (SDR family) member 13 [Source:HGNC Symbol;Acc:28326]
Mouse Orthologue:
Dhrs13
Mouse Description:
dehydrogenase/reductase (SDR family) member 13 Gene [Source:MGI Symbol;Acc:MGI:1917701]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2228 Splice Site, Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2228
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051587 Splice Site None 253 2 4
ENSDART00000131838 Splice Site, Nonsense 23 289 2 4
Genomic Location (Zv9):
Chromosome 5 (position 22709160)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20422032
KASP Assay ID:
554-2899.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCCCCCTTAAATGTCTCATGCTAACTGTGTCTGTATGTTTTGAGGT[G/T]GAAACTCTGGGATTGGGAAGGAGACGGCAGTGGCGCTGGCTATGCGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link