hs3st1l2

Ensembl ID:
ENSDARG00000035578
ZFIN ID:
ZDB-GENE-070202-3
Description:
heparan sulfate (glucosamine) 3-O-sulfotransferase 1-like 2 [Source:RefSeq peptide;Acc:NP_001035015

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20382 Nonsense Mutation detected in F1 DNA During 2014
sa16688 Nonsense Available for shipment Available now
sa16093 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051586 Nonsense 153 303 2 2
Genomic Location:
Chromosome 5 (position 22923255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGCTTTTGATCATTCGTGACCCCGCAGAGAGGCTCGTATCAGATTA[T/A]ACGCAAGTTCTCCACAACCGAATTCAGCAAAACAAGCCATACCAGTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051586 Nonsense 184 303 2 2
Genomic Location:
Chromosome 5 (position 22923348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGYCACTGGAAGAGCTGCTGCTTTCACAAGGACACATCRACCCCAAATA[C/A]AAGGCCCTTCAGAGAAGTTTTTACTACCAGCACCTRGCCAGATGGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051586 Nonsense 298 303 2 2
Genomic Location:
Chromosome 5 (position 22923688)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCCGCTACTTGMGAGTACCTAATCAAATCTTTTTCCGAATGGTGGGA[C/T]AGAGGTTTGACTGGTGCTAAAGACAGACGGAAAAGGATTGACAGCTCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5au9af90