cds2

Ensembl ID:
ENSDARG00000035577
ZFIN ID:
ZDB-GENE-030717-4
Description:
phosphatidate cytidylyltransferase 2 [Source:RefSeq peptide;Acc:NP_957480]
Human Orthologue:
CDS2
Human Description:
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 [Source:HGNC Symbol;Acc:1801]
Mouse Orthologue:
Cds2
Mouse Description:
CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31426 Nonsense Available for shipment Available now
sa38461 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028087 Nonsense 239 444 8 13
Genomic Location (Zv9):
Chromosome 5 (position 22949705)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20662577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTTATCGTGCCCATATCCTGCGTTATCTGTAATGACATCATGGCTTA[C/A]ATGTTTGGCTTCTTTTTCGGTCGCACCCCACTCATCAAGGTTTGTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028087 Essential Splice Site 252 444 8 13
Genomic Location (Zv9):
Chromosome 5 (position 22949745)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20662617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGCTTACATGTTTGGCTTCTTTTTCGGTCGCACCCCACTCATCAAG[G/A]TTTGTGCTTTTAGCATCACAGTATTACTGTTAAATAGTATTGTTTAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link