si:ch211-106a19.2

Ensembl ID:
ENSDARG00000035565
ZFIN ID:
ZDB-GENE-060526-4
Description:
V-type proton ATPase 116 kDa subunit a isoform 2 [Source:RefSeq peptide;Acc:NP_001116219]
Human Orthologue:
ATP6V0A2
Human Description:
ATPase, H+ transporting, lysosomal V0 subunit a2 [Source:HGNC Symbol;Acc:18481]
Mouse Orthologue:
Atp6v0a2
Mouse Description:
ATPase, H+ transporting, lysosomal V0 subunit A2 Gene [Source:MGI Symbol;Acc:MGI:104855]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33591 Nonsense Mutation detected in F1 DNA During 2017
sa33592 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40421 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Nonsense 151 849 5 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26216555)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24043820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTGCTTGGTTTTTGCTTGTGTGGGAGCAGAGAGAGTCAACACAGGGC[C/T]AGTATGAAGAATTCCCCTTTCTAGAGAAAGAACCCATGATGGACTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Essential Splice Site 247 849 8 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26218208)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24045473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTGTATTTTTAAGTTAAAATTGCTGATCAGAAACTTTTGTGTCTGT[A/G]GCTACCACTGTCACCTGTACCCATACCCCAACAGTAATGAGGAGAGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Nonsense 636 849 15 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26226140)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24053405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTATCAACATGTTCCTGATGATGGGCGACTCTGGCCGACCACTCTA[T/A]CCAGGACAGGTGAGAGTCAAGCAATCATGATGAACAGAATGCTTCATTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiponectin levels: Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link