dgcr8

Ensembl ID:
ENSDARG00000035564
ZFIN ID:
ZDB-GENE-030131-3421
Description:
microprocessor complex subunit DGCR8 [Source:RefSeq peptide;Acc:NP_001116221]
Human Orthologue:
DGCR8
Human Description:
DiGeorge syndrome critical region gene 8 [Source:HGNC Symbol;Acc:2847]
Mouse Orthologue:
Dgcr8
Mouse Description:
DiGeorge syndrome critical region gene 8 Gene [Source:MGI Symbol;Acc:MGI:2151114]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa223 Nonsense F2 line generated During 2017
sa40420 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa223
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051554 Nonsense 352 765 4 14
ENSDART00000124915 Nonsense 352 782 4 13
ENSDART00000144560 Nonsense 352 782 5 14
Genomic Location (Zv9):
Chromosome 5 (position 26193854)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24021119
KASP Assay ID:
554-0125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCACCAACCAGTAGCATTCCCTGCCTGCACTACAAGAAAATGAAGGAA[C/T]AAGAAGAAAGGGAACAGAATGGAGAGGTGACTCCGACAGCGGAGATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051554 Essential Splice Site 561 765 8 14
ENSDART00000124915 Essential Splice Site 578 782 7 13
ENSDART00000144560 Essential Splice Site 578 782 8 14
Genomic Location (Zv9):
Chromosome 5 (position 26195479)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24022744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGCACTGGAACAGCTAGTAGTAAAAAACTTGCCAAGAATAAAGCTGG[T/A]ATCTTTTCCCCGTTTCTGTTTGAGTCCTGTAATCTCAGCAAGAAATCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link