si:ch211-114c12.4

Ensembl ID:
ENSDARG00000035560
ZFIN ID:
ZDB-GENE-060531-6
Description:
Novel protein similar to vertebrate capping protein (Actin filament) gelsolin-like (CAPG) [Source:Un
Human Orthologue:
CAPG
Human Description:
capping protein (actin filament), gelsolin-like [Source:HGNC Symbol;Acc:1474]
Mouse Orthologue:
Capg
Mouse Description:
capping protein (actin filament), gelsolin-like Gene [Source:MGI Symbol;Acc:MGI:1098259]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9920 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051550 Nonsense 98 350 2 8
Genomic Location (Zv9):
Chromosome 5 (position 25792671)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23619936
KASP Assay ID:
2259-5760.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCATGCTTGCCACTCAACTGGACAGCTTCTTGGGAGGAGAGCCAGTG[C/T]AAYACAGACAGGTGCAGGGCTTCGAGTCRCATGAATTCATGGGACTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link