tp53

Ensembl ID:
ENSDARG00000035559
ZFIN ID:
ZDB-GENE-990415-270
Description:
Cellular tumor antigen p53 [Source:UniProtKB/Swiss-Prot;Acc:P79734]
Human Orthologue:
TP53
Human Description:
tumor protein p53 [Source:HGNC Symbol;Acc:11998]
Mouse Orthologue:
Trp53
Mouse Description:
transformation related protein 53 Gene [Source:MGI Symbol;Acc:MGI:98834]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20404 Nonsense Mutation detected in F1 DNA During 2014
sa1114 Essential Splice Site Available for shipment Available now
hu888 Essential Splice Site Confirmed mutation in F2 line Unknown
sa20405 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051549 Nonsense 48 374 4 11
ENSDART00000135934 Nonsense 47 369 4 11

The following transcripts of ENSDARG00000035559 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 25756440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTTGCCAGGAGTACTTGCCGGGATCGTTTGACCCCAATTTTTTT[G/T]AAAATGTGCTTGAAGAACAGCCTCAGCCATCCACTCTCCCACCAACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051549 Essential Splice Site 95 374 5 11
ENSDART00000135934 Essential Splice Site 94 369 5 11

The following transcripts of ENSDARG00000035559 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 25759271)
KASP Assay ID:
554-1016.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGTGCTAAACTATAACAACTGGGTGAAACTTATTTTTTTGTAATTGC[A/T]GTATTCACCGGACCTGAATAAACTCTTCTGTCAGCTGGCAAAAACTTGCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu888
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051549 Essential Splice Site 277 374 9 11
ENSDART00000135934 None None 369 None 11

The following transcripts of ENSDARG00000035559 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 25762707)
KASP Assay ID:
554-0030.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAATATTTTGCCTTATAATAGGAGGGTAATGTGAATCTAACCTGGCA[G/T]GTTTGGTGAAAGAATCTTCTTCAGCTACATTACGACCTGAGGGGAGCAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051549 Nonsense 339 374 10 11
ENSDART00000135934 Nonsense 334 369 10 11

The following transcripts of ENSDARG00000035559 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 25765573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTCTGGAGTTAAGTGATGTGGTGCCTGCCTCAGATGCTGAAAAGTA[T/A]CGTCAGAAATTGTAAGTTCTCAATTCCACTGTACAATTTGTGTGTGTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rmj4khqp