rps6ka3a

Ensembl ID:
ENSDARG00000035556
ZFIN ID:
ZDB-GENE-030219-119
Description:
ribosomal protein S6 kinase alpha-1 [Source:RefSeq peptide;Acc:NP_997951]
Human Orthologues:
RPS6KA3, RPS6KA6
Human Descriptions:
ribosomal protein S6 kinase, 90kDa, polypeptide 3 [Source:HGNC Symbol;Acc:10432]
ribosomal protein S6 kinase, 90kDa, polypeptide 6 [Source:HGNC Symbol;Acc:10435]
Mouse Orthologues:
Rps6ka3, Rps6ka6
Mouse Descriptions:
ribosomal protein S6 kinase polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:104557]
ribosomal protein S6 kinase polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1914321]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2273 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10515 Nonsense Available for shipment Available now
sa14662 Nonsense Available for shipment Available now
sa6974 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Essential Splice Site 33 732 2 22
Genomic Location:
Chromosome 5 (position 25693101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTTTGCAGGATGACTCCATGATTGAGGATGATTCTCTTGTTCACG[T/C]AAGTTGAAGACTGTCTGACTAACTATGTGTGTATTTATGTGAGTATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Nonsense 101 732 5 22
Genomic Location:
Chromosome 5 (position 25687339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTAAGCGTGTTATTGTTYGTTTACAATCTGGTTTGTGGTTTCAGTG[C/T]GAGATCGAGTGCGTACAAAAATGGAGAGGGACATTCTTGTTGAGGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Nonsense 500 732 17 22
Genomic Location:
Chromosome 5 (position 25682445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCACAGAGTTGATGAAAGGTGGAGAACTACTGGATAAAATCCTCCGA[C/T]AAAARTTTTTCTCTGAGAGAGAAGCAAGCGCTGTCCTCTACACCATWACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Nonsense 684 732 21 22
Genomic Location:
Chromosome 5 (position 25680703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATYCATGGATAATCAACAAGGACCAGTTACCCAAATACCAACTCAAT[C/T]GACAGGATGCTCCTCACCTAGTGAAGGTTTGCTTTGCTRTAATGGWCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0z2vy1qr