gbgt1l3

Ensembl ID:
ENSDARG00000035555
ZFIN ID:
ZDB-GENE-040912-46
Description:
globoside alpha-1,3-N-acetylgalactosaminyltransferase 1, like 3 [Source:RefSeq peptide;Acc:NP_00100
Mouse Orthologue:
Abo
Mouse Description:
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20400 Essential Splice Site Available for shipment Available now
sa26461 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051541 Essential Splice Site 32 342 3 7
Genomic Location (Zv9):
Chromosome 5 (position 25522292)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23349557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACTGACCAATGTTACAGCATTGACTATAACAACCATCTTTCTGTTGC[A/T]GACATATAGAGCAAAGATTCTGCCTCAAGTAAGTATTGTCACTGCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051541 Nonsense 78 342 6 7
Genomic Location (Zv9):
Chromosome 5 (position 25521181)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23348446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTTTTTTAAAACAGCCCAGATGGCAAAGTTGGTCCTCTGGCACCATG[G/A]TTAGCTCCAATTGTTTCTGAAGGAAGTTTTGATCCCACACTGATTGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link