cx27.5

Ensembl ID:
ENSDARG00000035553
ZFIN ID:
ZDB-GENE-010619-2
Description:
gap junction beta-1 protein [Source:RefSeq peptide;Acc:NP_571886]
Human Orthologue:
GJB1
Human Description:
gap junction protein, beta 1, 32kDa [Source:HGNC Symbol;Acc:4283]
Mouse Orthologue:
Gjb1
Mouse Description:
gap junction protein, beta 1 Gene [Source:MGI Symbol;Acc:MGI:95719]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40414 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051539 Nonsense 146 254 2 2
ENSDART00000121504 Nonsense 132 240 2 2
ENSDART00000121715 Nonsense 130 170 4 4
Genomic Location (Zv9):
Chromosome 5 (position 25296250)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23123515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTGGAGGCGATAAAGAACCAGAAGATGAAGATTACCGGCGCCCTCT[G/A]GTGGACATATATGATCAGCCTGCTGTTCCGTGTGTTGTTCGAGTCCGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link