si:dkey-114c15.1

Ensembl ID:
ENSDARG00000035550
ZFIN ID:
ZDB-GENE-060526-194
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQF2]
Human Orthologues:
CCDC42, CCDC42B
Human Descriptions:
coiled-coil domain containing 42 [Source:HGNC Symbol;Acc:26528]
coiled-coil domain containing 42B [Source:HGNC Symbol;Acc:37100]
Mouse Orthologue:
Ccdc42
Mouse Description:
coiled-coil domain containing 42 Gene [Source:MGI Symbol;Acc:MGI:3045254]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40410 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051530 Nonsense 92 313 3 8
ENSDART00000144846 Nonsense 92 286 3 6

The following transcripts of ENSDARG00000035550 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 24860141)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22687406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGAAGAGGAGAAACTAAAGAATTCCCTACTGCAATATAACAAGTTTT[T/A]GCAAGCAAGGCAACTTTCTGAAACAACTGCATCTATCAATGGATAATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link