jmjd7

Ensembl ID:
ENSDARG00000035546
ZFIN ID:
ZDB-GENE-050417-86
Description:
jmjC domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001017615]
Human Orthologues:
C2orf60, JMJD7
Human Descriptions:
chromosome 2 open reading frame 60 [Source:HGNC Symbol;Acc:26754]
jumonji domain containing 7 [Source:HGNC Symbol;Acc:34397]
Mouse Orthologue:
1110034B05Rik
Mouse Description:
RIKEN cDNA 1110034B05 gene Gene [Source:MGI Symbol;Acc:MGI:1915986]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13433 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051526 Nonsense 265 311 7 8
Genomic Location:
Chromosome 17 (position 10578619)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACATGCCAAAGCTCTGCACTGCACWGTTAAAGCAGGAGAGATGTTGTA[T/A]CTGCCCTCGCTCTGGTTCCATCATGTGCGACAGTCTCACGGCTGCATAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oawy1c6i