agxt2l1

Ensembl ID:
ENSDARG00000035544
ZFIN ID:
ZDB-GENE-040426-1133
Description:
Alanine--glyoxylate aminotransferase 2-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SY54]
Human Orthologue:
AGXT2L1
Human Description:
alanine-glyoxylate aminotransferase 2-like 1 [Source:HGNC Symbol;Acc:14404]
Mouse Orthologue:
Agxt2l1
Mouse Description:
alanine-glyoxylate aminotransferase 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919010]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21106 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051524 Splice Site, Nonsense 392 492 10 13
ENSDART00000135167 Splice Site None 125 5 8

The following transcripts of ENSDARG00000035544 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 60564778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGAGTAAAAGGACCCCTGCTACAGCTGAAGCTCAGGAGGTTATTTA[C/A]AGGTAAGAATAAGTTTGTAAAGAGTAATTCATATTGCACTGCCAGACATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2wglblux