si:ch211-199i18.4

Ensembl ID:
ENSDARG00000035538
ZFIN ID:
ZDB-GENE-091113-4
Human Orthologue:
ATP6V0A2
Human Description:
ATPase, H+ transporting, lysosomal V0 subunit a2 [Source:HGNC Symbol;Acc:18481]
Mouse Orthologue:
Atp6v0a2
Mouse Description:
ATPase, H+ transporting, lysosomal V0 subunit A2 Gene [Source:MGI Symbol;Acc:MGI:104855]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9960 Nonsense Available for shipment Available now
sa18975 Nonsense Mutation detected in F1 DNA During 2017
sa34840 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054119 Nonsense 609 842 15 20
ENSDART00000140476 Nonsense 609 842 16 21
ENSDART00000054119 Nonsense 609 842 15 20
ENSDART00000140476 Nonsense 609 842 16 21
Genomic Location (Zv9):
Chromosome 10 (position 7028186)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8040986
KASP Assay ID:
2260-2862.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGTACTTGGCCTTTATGATCTTTTACAAATGGCTGGCGTACACAGCA[C/T]GAGACTCACAGCTGGCACCGAGTATCCTCATCCACTTCATCAACATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054119 Nonsense 609 842 15 20
ENSDART00000140476 Nonsense 609 842 16 21
ENSDART00000054119 Nonsense 609 842 15 20
ENSDART00000140476 Nonsense 609 842 16 21
Genomic Location (Zv9):
Chromosome 10 (position 7028186)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8040986
KASP Assay ID:
2260-2862.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGTACTTGGCCTTTATGATCTTTTACAAATGGCTGGCGTACACAGCA[C/T]GAGACTCACAGCTGGCACCGAGTATCCTCATCCACTTCATCAACATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054119 Essential Splice Site 640 842 16 20
ENSDART00000140476 Essential Splice Site 640 842 17 21
Genomic Location (Zv9):
Chromosome 10 (position 7026268)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8039068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCAGAAAGCCGCTGATATCTGTGCATGTGTTCATGTTCTTGTGACA[G/T]ATGGGACTGCAGGTGTTTCTGGTGGTGGTGGCGCTGCTGTCGGTGCCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiponectin levels: Novel loci for adiponectin levels and their influence on type 2 diabetes and metabolic traits: a multi-ethnic meta-analysis of 45,891 individuals. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link