rasa1

Ensembl ID:
ENSDARG00000035535
ZFIN ID:
ZDB-GENE-030131-4694
Description:
Novel protein similar to vertebrate RAS p21 protein activator (GTPase activating protein) 1 (RASA1)
Human Orthologue:
RASA1
Human Description:
RAS p21 protein activator (GTPase activating protein) 1 [Source:HGNC Symbol;Acc:9871]
Mouse Orthologue:
Rasa1
Mouse Description:
RAS p21 protein activator 1 Gene [Source:MGI Symbol;Acc:MGI:97860]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10485 Nonsense Available for shipment Available now
sa15062 Nonsense Available for shipment Available now
sa20521 Nonsense Mutation detected in F1 DNA During 2014
sa15906 Essential Splice Site Available for shipment Available now
sa9711 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 324 972 8 26
ENSDART00000139824 Nonsense 319 952 8 25
Genomic Location:
Chromosome 5 (position 49709854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATTAGCCCCACTCCCAACAATCAGTACATGATGGGAGGACGCTACTA[T/A]AACAGGTAGGAATGCAGGCTGRGGTTTAAATGCCTGAAAGCATCAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 368 972 10 26
ENSDART00000139824 Nonsense 363 952 10 25
Genomic Location:
Chromosome 5 (position 49715088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCAAAAAGAGCAAGTTCTATCTGATTTGGTTGATGGCAGAGAAATATA[T/A]AACACTATTCGACGAAAAACAAAAGATGCTTTCTACAAAAACATCGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 373 972 10 26
ENSDART00000139824 Nonsense 368 952 10 25
Genomic Location:
Chromosome 5 (position 49715101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCTATCTGATTTGGTTGATGGCAGAGAAATATATAACACTATTCGA[C/T]GAAAAACAAAAGATGCTTTCTACAAAAACATCGTCAAGAAAGGATATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Essential Splice Site 739 972 18 26
ENSDART00000139824 Essential Splice Site 734 952 18 25
Genomic Location:
Chromosome 5 (position 49732880)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTAAAGACACCATACTGAAGATCATGGAGAGCAAGCAGTCMTGYGAG[G/A]TACAGCAAATAAACAAATAATAATATCCCACTTTTAAAAGGATAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Essential Splice Site 859 972 22 26
ENSDART00000139824 Essential Splice Site 854 952 22 25
Genomic Location:
Chromosome 5 (position 49738700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCAAAGTCTGTGCAAAACTTGGCCAACCTGGTGGAGTTTGGTGCCAAG[G/T]TGTTTAGATTTTCACGCTSAGTTCTAAAATGATCTKTGCTGAGAGAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/63p1vau1