si:ch211-93b22.1

Ensembl ID:
ENSDARG00000035533
ZFIN ID:
ZDB-GENE-060526-185
Description:
Novel protein similar to vertebrate tachykinin receptor 1 (TACR1) [Source:UniProtKB/TrEMBL;Acc:A2BIP
Human Orthologue:
TACR1
Human Description:
tachykinin receptor 1 [Source:HGNC Symbol;Acc:11526]
Mouse Orthologue:
Tacr1
Mouse Description:
tachykinin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:98475]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20433 Essential Splice Site Available for shipment Available now
sa31443 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051516 Essential Splice Site 201 413 2 6
ENSDART00000141109   None 411 None 5
Genomic Location (Zv9):
Chromosome 5 (position 29821000)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27576298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTACATCGACTGGCCCGAGTACACTCTCCTGGACTTCAAAACAATG[T/A]AAACATCTCTATTACACTCAAAAGAATACTTCTGCTGCTTGTTCAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051516 Nonsense 306 413 4 6
ENSDART00000141109 Nonsense 291 411 4 5
Genomic Location (Zv9):
Chromosome 5 (position 29857516)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27612814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGGTCTATCTGACTATCATGTGGCTGGCAATGAGCTCCACCATGTA[C/A]AACCCCATTATCTACTGCTGCCTCAATGACAGGTAATTTCACCTGAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link