sfrp1a

Ensembl ID:
ENSDARG00000035521
ZFIN ID:
ZDB-GENE-040310-5
Description:
secreted frizzled-related protein 1a [Source:RefSeq peptide;Acc:NP_991148]
Human Orthologue:
SFRP1
Human Description:
secreted frizzled-related protein 1 [Source:HGNC Symbol;Acc:10776]
Mouse Orthologue:
Sfrp1
Mouse Description:
secreted frizzled-related protein 1 Gene [Source:MGI Symbol;Acc:MGI:892014]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33610 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051491 Nonsense 74 296 1 3
ENSDART00000123635   None 104 None 4
Genomic Location (Zv9):
Chromosome 5 (position 29170459)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26925757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGCTGCTGCCCAACTTGCTGGAGCATGAGAGTATGGCTGAGGTCAAG[C/T]AGCAAGCGGGCAGCTGGGTGCCTCTGTTGCATAAGAACTGCGACCCAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link