adam28

Ensembl ID:
ENSDARG00000035514
ZFIN ID:
ZDB-GENE-060929-532
Description:
a disintegrin and metallopeptidase domain 28 [Source:RefSeq peptide;Acc:NP_001070186]
Human Orthologues:
ADAM28, ADAM7
Human Descriptions:
ADAM metallopeptidase domain 28 [Source:HGNC Symbol;Acc:206]
ADAM metallopeptidase domain 7 [Source:HGNC Symbol;Acc:214]
Mouse Orthologues:
Adam28, Adam7
Mouse Descriptions:
a disintegrin and metallopeptidase domain 28 Gene [Source:MGI Symbol;Acc:MGI:105988]
a disintegrin and metallopeptidase domain 7 Gene [Source:MGI Symbol;Acc:MGI:107247]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11354 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098604 Essential Splice Site 453 762 13 21
ENSDART00000130936 None None 293 None 9

The following transcripts of ENSDARG00000035514 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 29556829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTGTGGGCTCACAATGTGCAGCAGGAGAATGTTGTGACAACTGTAAG[G/A]TAWAGTGGAGGTTTYTTGCTGTKTCATTCATCAAATCRCCAAAGGATTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • White matter integrity (interaction): White matter integrity as an intermediate phenotype: exploratory genome-wide association analysis in individuals at high risk of bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9bm01o2r