si:ch211-89p1.3

Ensembl ID:
ENSDARG00000035507
ZFIN ID:
ZDB-GENE-030131-3973
Description:
Novel protein (LOC558111) [Source:UniProtKB/TrEMBL;Acc:A2BFD1]
Human Orthologue:
DDX31
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 [Source:HGNC Symbol;Acc:16715]
Mouse Orthologue:
Ddx31
Mouse Description:
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 Gene [Source:MGI Symbol;Acc:MGI:2682639]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26493 Nonsense Mutation detected in F1 DNA During 2017
sa40456 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13609 Nonsense Available for shipment Available now
sa20446 Nonsense Available for shipment Available now
sa40457 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051473 Nonsense 155 673 5 19
ENSDART00000143183   None 218 None 5
ENSDART00000148314 Nonsense 221 739 6 20
Genomic Location (Zv9):
Chromosome 5 (position 31354790)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29116147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACATTGGCATATGGGATTCCAATGGTTCAGTTTTTACAAGCGATT[C/T]AACCGAAAGTCAAGGCAAGTCAAGTCTTGAACAACTCAATTTAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051473 Essential Splice Site 188 673 7 19
ENSDART00000143183   None 218 None 5
ENSDART00000148314 Essential Splice Site 254 739 8 20
Genomic Location (Zv9):
Chromosome 5 (position 31355927)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29117284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGCTTGCCTTGCAGAGCTTTCAGATGTTTCAGAAGCTTCTTAGAG[T/A]GAGAATTTACCTCTTTTTCTATATTTCTGAAGTCATTGAAATTTCACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051473 Nonsense 347 673 11 19
ENSDART00000143183   None 218 None 5
ENSDART00000148314 Nonsense 413 739 12 20
Genomic Location (Zv9):
Chromosome 5 (position 31357893)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29119250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTRCAGCAGCACGTGGTGGTGGTGCCCAGCAAGCTCCACCTGGTCTG[T/A]TTGGCTGCCKTTATTCTGGCCAAATGCAAGGTAGAGAGGACCGTTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051473 Nonsense 439 673 14 19
ENSDART00000143183 Nonsense 7 218 1 5
ENSDART00000148314 Nonsense 505 739 15 20
Genomic Location (Zv9):
Chromosome 5 (position 31364937)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29126294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATAGTTTTTTGTTTATTTTTCCCTCAGGATGTAGCTGCACGTGGTT[T/A]GGATTTGCCTCAGGTTACTTGGATTGTTCAGGTTTGATTTCTTCATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051473 Nonsense 663 673 19 19
ENSDART00000143183   None 218 None 5
ENSDART00000148314 Nonsense 729 739 20 20
Genomic Location (Zv9):
Chromosome 5 (position 31383715)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29145072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAGTGGCATGGATGGACAATCTAAGGCTAAGAAGAAAAGGAAAAAT[A/T]AGAAGGGTCAAGCAGAGGAATCTACCGATGCATAAAGTGGCCAATACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link