entpd2a.1

Ensembl ID:
ENSDARG00000035506
ZFIN ID:
ZDB-GENE-040724-187
Description:
ectonucleoside triphosphate diphosphohydrolase 2 a.1 [Source:RefSeq peptide;Acc:NP_001004643]
Human Orthologue:
ENTPD2
Human Description:
ectonucleoside triphosphate diphosphohydrolase 2 [Source:HGNC Symbol;Acc:3364]
Mouse Orthologue:
Entpd2
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1096863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11627 Nonsense Available for shipment Available now
sa31447 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051434 Nonsense 78 502 2 9
ENSDART00000136446 Nonsense 78 453 2 9
Genomic Location (Zv9):
Chromosome 5 (position 31220306)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28981663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCCAGCAGATAAGCAGAACGGCACTGGCATTGTCAGTCAGCACAGC[G/T]AGTGCCATGCAAAGGGTGAGTGTTTAATGATWAATGGCTTCTTCCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051434 Essential Splice Site 82 502 2 9
ENSDART00000136446 Essential Splice Site 82 453 2 9
Genomic Location (Zv9):
Chromosome 5 (position 31220290)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28981647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAACGGCACTGGCATTGTCAGTCAGCACAGCGAGTGCCATGCAAAGG[G/A]TGAGTGTTTAATGATAAATGGCTTCTTCCTCATTTGGATGTCCGTTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link