entpd2a.1

Ensembl ID:
ENSDARG00000035506
ZFIN ID:
ZDB-GENE-040724-187
Description:
ectonucleoside triphosphate diphosphohydrolase 2 a.1 [Source:RefSeq peptide;Acc:NP_001004643]
Human Orthologue:
ENTPD2
Human Description:
ectonucleoside triphosphate diphosphohydrolase 2 [Source:HGNC Symbol;Acc:3364]
Mouse Orthologue:
Entpd2
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1096863]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11627 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051434 Nonsense 78 502 2 9
ENSDART00000136446 Nonsense 78 453 2 9
Genomic Location:
Chromosome 5 (position 31220306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCCAGCAGATAAGCAGAACGGCACTGGCATTGTCAGTCAGCACAGC[G/T]AGTGCCATGCAAAGGGTGAGTGTTTAATGATWAATGGCTTCTTCCTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d1nad1ja