cobra1

Ensembl ID:
ENSDARG00000035505
ZFIN ID:
ZDB-GENE-040426-765
Description:
cofactor of BRCA1 isoform 2 [Source:RefSeq peptide;Acc:NP_956462]
Human Orthologue:
COBRA1
Human Description:
cofactor of BRCA1 [Source:HGNC Symbol;Acc:24324]
Mouse Orthologue:
Cobra1
Mouse Description:
cofactor of BRCA1 Gene [Source:MGI Symbol;Acc:MGI:1931035]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20444 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17245 Nonsense Available for shipment Available now
sa12379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 Essential Splice Site 34 591 1 15
ENSDART00000051471 Essential Splice Site 34 583 1 13
ENSDART00000133949 Essential Splice Site 34 577 1 13
Genomic Location:
Chromosome 5 (position 31198145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTGACTAACTGTACTGAACCTCTCAAAGCAATCGACCAGTTTCAGG[T/C]TAGATCTTTACAAACGTACACATGTCCTGTCTGTCATGTTCGTGATTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 Nonsense 293 591 6 15
ENSDART00000051471 Nonsense 293 583 6 13
ENSDART00000133949 Nonsense 293 577 6 13
Genomic Location:
Chromosome 5 (position 31192395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAACGGGCCMGAGAGTTACAAGGCTTTTTGGATGGTGTGAAGAAAGGC[C/T]AGGAGCAAGTGTTAGGGTATGAGATTCAWWTTTAATTCTACAGACAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 None 378 591 9 15
ENSDART00000051471 Nonsense 378 583 9 13
ENSDART00000133949 Nonsense 378 577 9 13
Genomic Location:
Chromosome 5 (position 31191412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCTTCAGGATCTGGAGGTGGTGACACGCTTTCTGCCTGCCATGATGT[C/A]RATAGTGGTGGACGACTACACGTTTACWGTRGAGCAGAAACWGCCGAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/od3k00pb