sh3glb2b

Ensembl ID:
ENSDARG00000035470
ZFIN ID:
ZDB-GENE-040426-833
Description:
SH3-domain GRB2-like endophilin B2b [Source:RefSeq peptide;Acc:NP_957413]
Human Orthologue:
SH3GLB2
Human Description:
SH3-domain GRB2-like endophilin B2 [Source:HGNC Symbol;Acc:10834]
Mouse Orthologue:
Sh3glb2
Mouse Description:
SH3-domain GRB2-like endophilin B2 Gene [Source:MGI Symbol;Acc:MGI:2385131]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20457 Nonsense Available for shipment Available now
sa1938 Nonsense Available for shipment Available now
sa30861 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16553 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Nonsense 77 373 3 10
ENSDART00000134427 Nonsense 77 238 3 7
ENSDART00000147065 Nonsense 77 402 3 12
ENSDART00000147779 Nonsense 77 397 3 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33316031)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31078263
KASP Assay ID:
2259-6014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTACTGATGTGAATGTTTGTTCAGGTGCCCGTATTGAGGAGTTCTTCTA[T/A]GAGAAACTAGACAAAAAGATCCCATCCAGAATCACCAATGCAGAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Nonsense 134 373 4 10
ENSDART00000134427 Nonsense 134 238 4 7
ENSDART00000147065 Nonsense 134 402 4 12
ENSDART00000147779 Nonsense 134 397 4 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33309544)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31071776
KASP Assay ID:
554-1926.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTGGAGAGTATCAAAAGAGGCTGGGTGGATCCGAGCGGGAATTTCTA[C/T]AAACATCAGCCATCAACTTCCTTACACCTCTGAGGAATTTTCTGGAGGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa30861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Essential Splice Site 187 373 5 10
ENSDART00000134427 Essential Splice Site 187 238 5 7
ENSDART00000147065 Essential Splice Site 187 402 5 12
ENSDART00000147779 Essential Splice Site 187 397 5 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33307924)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31070156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAAAGCTCGGCTCAAGAAAGCAAAGTTAGCAGAGGCCAAGGCAGCTG[T/A]AAGCTCTTATTTTGACTTATCTCAACATCTTTATGGTCACAAGATTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Essential Splice Site 339 373 10 10
ENSDART00000134427   None 238 None 7
ENSDART00000147065 Essential Splice Site 368 402 12 12
ENSDART00000147779 Essential Splice Site 363 397 11 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33282866)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31045098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCGACACACCCAAGGGTCTTTTTCATGTTATTGTTTGTTTCTTTGTA[G/A]CTGATTACGGTGTACACGGTGCCCGGCATGGACCCAGACTGGCTTATCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link