atp2a1l

Ensembl ID:
ENSDARG00000035458
ZFIN ID:
ZDB-GENE-041229-2
Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 like [Source:RefSeq peptide;Acc:NP_0010710
Human Orthologue:
ATP2A1
Human Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 [Source:HGNC Symbol;Acc:811]
Mouse Orthologue:
Atp2a1
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 Gene [Source:MGI Symbol;Acc:MGI:105058]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7691 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19032 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3830 Nonsense Mutation detected in F1 DNA During 2014
sa1409 Nonsense Available for shipment Available now
sa14828 Nonsense Mutation detected in F1 DNA During 2014
sa22052 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
Genomic Location:
Chromosome 12 (position 14354548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATCAAGGCCAGAGAGATTGTGCCTGGWGACATTGTGGAGGTGTCTG[G/A]TAAGACTCCTTTATGTCCTTCAGTCTTTGATTTGGAAAGGCGTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
Genomic Location:
Chromosome 12 (position 14354548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATCAAGGCCAGAGAGATTGTGCCTGGTGACATTGTGGAGGTGTCTG[G/A]TAAGACTCCTTTATGTCCTTCAGTCTTTGATTTGGAAAGGCGTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 406 991 11 24
ENSDART00000144542 Nonsense 333 918 8 21
Genomic Location:
Chromosome 12 (position 14359506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCATATCATTTCTTCAGCACAAAGYTGGGTGCCAAAGTTGACTGCAGT[C/T]AATAWGAYGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAAYGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 407 991 11 24
ENSDART00000144542 Nonsense 334 918 8 21
Genomic Location:
Chromosome 12 (position 14359511)
KASP Assay ID:
554-1330.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCATTTCTTCAGCACAAAGYTGGGTGCCAAAGTTGACTGCAGTCAATA[T/A]GAYGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAAYGATTCCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 829 991 18 24
ENSDART00000144542 Nonsense 756 918 15 21
Genomic Location:
Chromosome 12 (position 14362596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGGGCAAACCTCCCCGCTCYCCCAAAGARCCCCTGATTTCTGGCTG[G/A]TTGTTCTTCAGATACATGACCGTTGGTGGTAGGTGTRCTTGTTANTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 838 991 18 24
ENSDART00000144542 Essential Splice Site 765 918 15 21
Genomic Location:
Chromosome 12 (position 14362625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCCCTGATTTCTGGCTGGTTGTTCTTCAGATACATGACCGTTGGTG[G/A]TAGGTGTACTTGTTATTTTTTGTGGAATATCTTTAGTAACATTCTCTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/th5th4bl