camkk1

Ensembl ID:
ENSDARG00000035452
ZFIN ID:
ZDB-GENE-050327-62
Description:
calcium/calmodulin-dependent protein kinase kinase 1 [Source:RefSeq peptide;Acc:NP_001014361]
Human Orthologue:
CAMKK1
Human Description:
calcium/calmodulin-dependent protein kinase kinase 1, alpha [Source:HGNC Symbol;Acc:1469]
Mouse Orthologue:
Camkk1
Mouse Description:
calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene [Source:MGI Symbol;Acc:MGI:1891766]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6985 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20454 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028237 Essential Splice Site 303 434 11 15
ENSDART00000133743 Essential Splice Site 350 481 13 17
Genomic Location:
Chromosome 5 (position 33050992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTCTTCACAATAAGATCAAGAGTAAAGTGGTGGAGTTCCCCGACAC[G/A]TAAGKCACCCCACAGGAACAGATGCAGAGARAGGAAATGTCAGAGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028237 Nonsense 316 434 12 15
ENSDART00000133743 Nonsense 363 481 14 17
Genomic Location:
Chromosome 5 (position 33055587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATATCTTAGACCGACTGTCAGCGAGGGGCTGAAGAGCCTGGTCTCA[C/T]GAATGCTGGACAAAAACCCAGACACCAGGATCACCATTCCTGAGATCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x9navkg8