myhc4

Ensembl ID:
ENSDARG00000035438
ZFIN ID:
ZDB-GENE-030131-6206
Description:
myosin heavy chain 4 [Source:RefSeq peptide;Acc:NP_001018321]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9273 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3545 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20460 Nonsense Available for shipment Available now
sa20461 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051362 Essential Splice Site 69 1937 2 40
ENSDART00000077471 None None 105 None 4
ENSDART00000125917 Essential Splice Site 69 1935 3 41
ENSDART00000131133 Essential Splice Site 69 1078 3 25
Genomic Location:
Chromosome 5 (position 33860125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCAAAGACGGTGGCAAAGTCACCGTTATTACGCTTGACACTAAGGAG[G/A]TGAATTTTTACCCTTTGCATAAATGAATCAAAATTACAAAGCCTTTMTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051362 Essential Splice Site 384 1937 12 40
ENSDART00000077471 None None 105 None 4
ENSDART00000125917 Essential Splice Site 384 1935 13 41
ENSDART00000131133 Essential Splice Site 384 1078 13 25
Genomic Location:
Chromosome 5 (position 33863529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTTTCAAGGCAAGAAAATGATTAAGAGTTTTGTAATGTTTCAATTGC[A/T]GAGGCTGACAAAATCTCTTACCTATTGGGTTTGAACTCTGCTGAATTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051362 Nonsense 723 1937 18 40
ENSDART00000077471 None None 105 None 4
ENSDART00000125917 Nonsense 721 1935 19 41
ENSDART00000131133 Nonsense 721 1078 19 25
Genomic Location:
Chromosome 5 (position 33865176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAATCTGCAGAAAGGGTTTCCCCAGCAGAATCCTCTATGGTGACTTC[A/T]AGCAGAGGTAAATGGGACTTTATATAAACATGTAATTTATTTACTGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051362 Nonsense 744 1937 19 40
ENSDART00000077471 None None 105 None 4
ENSDART00000125917 Nonsense 742 1935 20 41
ENSDART00000131133 Nonsense 742 1078 20 25
Genomic Location:
Chromosome 5 (position 33865328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGTTGAATGCCAGTGTTATCCCAGAGGGACAGTTCATTGACAACAAG[A/T]AGGCCAGTGAGAAACTCCTGGGATCTATTGATGTTAATCATGATGAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3c8ors0u