m17

Ensembl ID:
ENSDARG00000035435
ZFIN ID:
ZDB-GENE-060526-368
Description:
IL-6 subfamily cytokine M17 [Source:RefSeq peptide;Acc:NP_001073302]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38482 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa15192 Nonsense Available for shipment Available now
sa30618 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051369 Splice Site, Nonsense 13 215 1 3
ENSDART00000137503   16 219 1 3
Genomic Location:
Chromosome 5 (position 33795773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATGTCAGGAACATGCTCTGCCTGTCTCAGAGATTGCAAGTCAAATTC[A/T]GTAAGTATTACCGCCACACTGCACACTCAACAATACGCTCATAGTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051369 Nonsense 44 215 2 3
ENSDART00000137503 Nonsense 48 219 2 3
Genomic Location:
Chromosome 5 (position 33795418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACCAACAATGTCATGCAAGAACGAAAACTGCAGCCAGCGTCTTCAC[C/T]GAAGTCTGAAGCTCAACAAGTTTACAAACAAGATRACAGTGAAGCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051369 Nonsense 92 215 3 3
ENSDART00000137503 Nonsense 96 219 3 3
Genomic Location:
Chromosome 5 (position 33793300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAATGCAAATGGACAATGTTCCAGTGTCTACAATCTCCGGTCAGACT[G/T]AATCGGAGCGCATCTTAAGTATGTATTCCCACCTGAAGGCGTTTCTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link