m17

Ensembl ID:
ENSDARG00000035435
ZFIN ID:
ZDB-GENE-060526-368
Description:
IL-6 subfamily cytokine M17 [Source:RefSeq peptide;Acc:NP_001073302]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15192 Nonsense Available for shipment Available now
sa30618 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa15192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051369 Nonsense 44 215 2 3
ENSDART00000137503 Nonsense 48 219 2 3
Genomic Location:
Chromosome 5 (position 33795418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACCAACAATGTCATGCAAGAACGAAAACTGCAGCCAGCGTCTTCAC[C/T]GAAGTCTGAAGCTCAACAAGTTTACAAACAAGATRACAGTGAAGCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051369 Nonsense 92 215 3 3
ENSDART00000137503 Nonsense 96 219 3 3
Genomic Location:
Chromosome 5 (position 33793300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAATGCAAATGGACAATGTTCCAGTGTCTACAATCTCCGGTCAGACT[G/T]AATCGGAGCGCATCTTAAGTATGTATTCCCACCTGAAGGCGTTTCTGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uyhffnmd