ophn1

Ensembl ID:
ENSDARG00000035420
ZFIN ID:
ZDB-GENE-040718-464
Description:
oligophrenin 1 [Source:RefSeq peptide;Acc:NP_001002709]
Human Orthologue:
OPHN1
Human Description:
oligophrenin 1 [Source:HGNC Symbol;Acc:8148]
Mouse Orthologue:
Ophn1
Mouse Description:
oligophrenin 1 Gene [Source:MGI Symbol;Acc:MGI:2151070]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11653 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044443 Nonsense 19 251 1 9
ENSDART00000046157 Nonsense 19 266 1 8
ENSDART00000051334 Nonsense 19 756 1 24
ENSDART00000123562 Nonsense 19 800 1 25

The following transcripts of ENSDARG00000035420 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 37361232)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KKCATCCTGCACTGGAGTTCAGCGACTGTTACTCCGACAGCCCCGATTTC[A/T]GAGAGAGATTGAAATGCTACGAAAACGAGCTGGAGAAAACCAACAAGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/szblka5x