enc1

Ensembl ID:
ENSDARG00000035398
ZFIN ID:
ZDB-GENE-060531-140
Description:
Novel protein similar to vertebrate ectodermal-neural cortex (With BTB-like domain) (ENC1) [Source:U
Human Orthologue:
ENC1
Human Description:
ectodermal-neural cortex 1 (with BTB-like domain) [Source:HGNC Symbol;Acc:3345]
Mouse Orthologue:
Enc1
Mouse Description:
ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38486 Nonsense Mutation detected in F1 DNA During 2016
sa9520 Nonsense Available for shipment Available now
sa6991 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 203 589 2 2
ENSDART00000141338 Nonsense 205 591 3 4
Genomic Location:
Chromosome 5 (position 36242940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCTGCCCAAGGACATGCTGGTGCAACTTCTGGCACATGAAGAACTC[G/T]AAACAGAGGACGAGCGGCTAGTCTACGAGTCGGCGCTCAATTGGGTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 368 589 2 2
ENSDART00000141338 Nonsense 370 591 3 4
Genomic Location:
Chromosome 5 (position 36243437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGTGTGTCCAAGGACGTTTGGGTGTACGATACATTACACGARGAATG[G/A]TCCAAGGCAGCTCCGATGTTGATAGCTCGTTTYGGTCATGGCTCGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 406 589 2 2
ENSDART00000141338 Nonsense 408 591 3 4
Genomic Location:
Chromosome 5 (position 36243550)
KASP Assay ID:
554-4749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTATGTCGTCGGAGGTCAYACAGCTGCCACTGGCTGTCTGCCTGCAT[C/A]ACCATCTGTGTCCTTGAAGCAGGTAGAGCAGTTTGACCCAGTTGCTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link