enc1

Ensembl ID:
ENSDARG00000035398
ZFIN ID:
ZDB-GENE-060531-140
Description:
Novel protein similar to vertebrate ectodermal-neural cortex (With BTB-like domain) (ENC1) [Source:U
Human Orthologue:
ENC1
Human Description:
ectodermal-neural cortex 1 (with BTB-like domain) [Source:HGNC Symbol;Acc:3345]
Mouse Orthologue:
Enc1
Mouse Description:
ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9520 Nonsense Available for shipment Available now
sa6991 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 368 589 2 2
ENSDART00000141338 Nonsense 370 591 3 4
Genomic Location:
Chromosome 5 (position 36243437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGTGTGTCCAAGGACGTTTGGGTGTACGATACATTACACGARGAATG[G/A]TCCAAGGCAGCTCCGATGTTGATAGCTCGTTTYGGTCATGGCTCGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 406 589 2 2
ENSDART00000141338 Nonsense 408 591 3 4
Genomic Location:
Chromosome 5 (position 36243550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTATGTCGTCGGAGGTCAYACAGCTGCCACTGGCTGTCTGCCTGCAT[C/A]ACCATCTGTGTCCTTGAAGCAGGTAGAGCAGTTTGACCCAGTTGCTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/06rk5mxp