ptcd2

Ensembl ID:
ENSDARG00000035391
ZFIN IDs:
ZDB-GENE-050417-82, ZDB-GENE-050417-82
Description:
Pentatricopeptide repeat-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q566X6]
Human Orthologue:
PTCD2
Human Description:
pentatricopeptide repeat domain 2 [Source:HGNC Symbol;Acc:25734]
Mouse Orthologue:
Ptcd2
Mouse Description:
pentatricopeptide repeat domain 2 Gene [Source:MGI Symbol;Acc:MGI:1916177]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6058 Nonsense Mutation detected in F1 DNA During 2017
sa20470 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051279 Nonsense 254 381 8 10
ENSDART00000114981 Nonsense 254 381 8 10
Genomic Location (Zv9):
Chromosome 5 (position 36876769)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34658718
KASP Assay ID:
554-3933.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATCTATTTTGTGGTTKTAGAATGATCTAGAAAGAGCCCAGATCTTCTA[T/A]TCTCACATCATGAGCACAGGGACTCGGCTATGCCAGAACCTGAGGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051279 Essential Splice Site 307 381 9 10
ENSDART00000114981 Essential Splice Site 307 381 9 10
Genomic Location (Zv9):
Chromosome 5 (position 36876529)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34658478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAGACTCCAGTGCTGGTGAGGAAACCAGAGTTTTCTCGAGAAGTGG[T/A]AAGATATCAACTACACCAGTCGAGTCTCCACACACGTACTCTACTTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link