TNPO1

Ensembl ID:
ENSDARG00000035390
Description:
transportin 1 [Source:HGNC Symbol;Acc:6401]
Human Orthologue:
TNPO1
Human Description:
transportin 1 [Source:HGNC Symbol;Acc:6401]
Mouse Orthologue:
Tnpo1
Mouse Description:
transportin 1 Gene [Source:MGI Symbol;Acc:MGI:2681523]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8407 Nonsense Mutation detected in F1 DNA During 2018
sa15569 Nonsense Available for shipment Available now
sa45211 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051278 Nonsense 472 701 11 18
Genomic Location (Zv9):
Chromosome 5 (position 36834323)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34616272
GRCz11 5 35216425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGATCTGCTCAGTGGTTTAGCAGAGGGTCTCGGCGGGAACATTGAA[C/T]AGCTGGTTGCACGAAGCAACATTCTCACACTTATGTACCAGTGCATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051278 Nonsense 476 701 11 18
Genomic Location (Zv9):
Chromosome 5 (position 36834311)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34616260
GRCz11 5 35216413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGGTTTAGCAGAGGGTCTCGGCGGGAACATTGAAYAGCTGGTTGCA[C/T]GAAGCAACATTCTCACACTTATGTACCAGTGCATGCAGGTAACTCTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051278 Essential Splice Site 551 701 13 18
Genomic Location (Zv9):
Chromosome 5 (position 36831834)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34613783
GRCz11 5 35213936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAACAACGCAACATGGGCCATTGGAGAAATCTCCATTCAAATGGG[T/G]AAACGTTTCATCATCATTTTCAGCTATTCGGTTCACTGATTTCATCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link