TNPO1

Ensembl ID:
ENSDARG00000035390
Description:
transportin 1 [Source:HGNC Symbol;Acc:6401]
Human Orthologue:
TNPO1
Human Description:
transportin 1 [Source:HGNC Symbol;Acc:6401]
Mouse Orthologue:
Tnpo1
Mouse Description:
transportin 1 Gene [Source:MGI Symbol;Acc:MGI:2681523]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8407 Nonsense Mutation detected in F1 DNA During 2014
sa15569 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051278 Nonsense 472 701 11 18
Genomic Location:
Chromosome 5 (position 36834323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGATCTGCTCAGTGGTTTAGCAGAGGGTCTCGGCGGGAACATTGAA[C/T]AGCTGGTTGCACGAAGCAACATTCTCACACTTATGTACCAGTGCATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051278 Nonsense 476 701 11 18
Genomic Location:
Chromosome 5 (position 36834311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGGTTTAGCAGAGGGTCTCGGCGGGAACATTGAAYAGCTGGTTGCA[C/T]GAAGCAACATTCTCACACTTATGTACCAGTGCATGCAGGTAACTCTATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/akg67g0m