si:ch211-195c22.1

Ensembl ID:
ENSDARG00000035389
ZFIN IDs:
ZDB-GENE-050522-228, ZDB-GENE-060526-70
Description:
FCH domain only protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q502I9]
Human Orthologue:
FCHO2
Human Description:
FCH domain only 2 [Source:HGNC Symbol;Acc:25180]
Mouse Orthologue:
Fcho2
Mouse Description:
FCH domain only 2 Gene [Source:MGI Symbol;Acc:MGI:3505790]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33648 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051271 Nonsense 200 848 6 27
ENSDART00000139673   None 569 None 18
ENSDART00000141218   None 299 None 8

The following transcripts of ENSDARG00000035389 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36796161)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34578110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACGCCACTGCCAAGACTGAATTTGAGCAAAGAATGACAGAAACCGCA[C/T]AAGTAAGATGTGGTGGAGTGTGTTTGTTGGGGTCTGCGTTATGGGTGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link