fgf5

Ensembl ID:
ENSDARG00000035377
ZFIN ID:
ZDB-GENE-050201-6
Description:
fibroblast growth factor 5 [Source:RefSeq peptide;Acc:NP_001009561]
Human Orthologue:
FGF5
Human Description:
fibroblast growth factor 5 [Source:HGNC Symbol;Acc:3683]
Mouse Orthologue:
Fgf5
Mouse Description:
fibroblast growth factor 5 Gene [Source:MGI Symbol;Acc:MGI:95519]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051256 Nonsense 142 225 3 3
Genomic Location (Zv9):
Chromosome 5 (position 41162587)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38956479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACATACGCCTCGGTGATCCACAAAAACCATCGCACTGGTAGAGAGTG[G/A]TTTGTGGCCCTCAACAAGAGAGGAAAAGCAAAAATGGGGTCCAGTCCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link