LOC100002327

Ensembl ID:
ENSDARG00000035367
Human Orthologues:
CLDN22, CLDN24, CLDN25
Human Descriptions:
claudin 22 [Source:HGNC Symbol;Acc:2044]
claudin 24 [Source:HGNC Symbol;Acc:37200]
claudin 25 [Source:HGNC Symbol;Acc:37218]
Mouse Orthologues:
AC160137.1, Cldn22, Cldn24
Mouse Descriptions:
claudin 22 Gene [Source:MGI Symbol;Acc:MGI:1922927]
claudin 24 Gene [Source:MGI Symbol;Acc:MGI:3712484]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41921 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051243 Nonsense 199 216 1 1
Genomic Location (Zv9):
Chromosome 11 (position 45263328)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43865595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGATCACATCTTGCTTCTTTCTGCAAGATAAAACAAGGGGTTTAGGG[G/T]AATCTATACATATGGATAGAGTCAACGGGACACGATCTCCACGCAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link