ENSDARG00000035366

Ensembl ID:
ENSDARG00000035366
Human Orthologue:
CLASP1
Human Description:
cytoplasmic linker associated protein 1 [Source:HGNC Symbol;Acc:17088]
Mouse Orthologue:
Clasp1
Mouse Description:
CLIP associating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1923957]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35164 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051242 Nonsense 41 94 2 3
Genomic Location (Zv9):
Chromosome 11 (position 45205684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTCCCAGTTCTGCCCAGTTTAATGGACCGTTTAGGTGATTCTAAA[G/T]AGCAAGTTCGAGATCAGGCGCAGTCACTTCTGCTGAAAATGATGGATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link