mink1

Ensembl ID:
ENSDARG00000035360
ZFIN ID:
ZDB-GENE-060526-45
Description:
misshapen-like kinase 1 [Source:RefSeq peptide;Acc:NP_001083048]
Human Orthologue:
MINK1
Human Description:
misshapen-like kinase 1 [Source:HGNC Symbol;Acc:17565]
Mouse Orthologue:
Mink1
Mouse Description:
misshapen-like kinase 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1355329]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40516 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20489 Nonsense Available for shipment Available now
sa20488 Nonsense Available for shipment Available now
sa40515 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20487 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40514 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236 Essential Splice Site 213 1287 7 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Essential Splice Site 213 1270 6 31
ENSDART00000140337   None 208 None 5
Genomic Location (Zv9):
Chromosome 5 (position 39958669)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37758059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGTCATTGCCTGTGATGAAAATCCCGACTCCACCTATGATTACAGG[G/A]TAAAATGAGCTTCTGACTGTTGATGCACACTAAACTGTTCAAAAGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236 Nonsense 451 1287 14 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Nonsense 449 1270 13 31
ENSDART00000140337 Nonsense 88 208 4 5
Genomic Location (Zv9):
Chromosome 5 (position 39931523)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37730913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTGCTTAATGACTTATTAATTGTTTGTTCATGTGTGTGTAGGAGTA[T/G]AAGCGTAAACAGCTGGAGGAGCAGAGACAGTCAGAGAGGCTTCAGAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236 Nonsense 461 1287 14 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Nonsense 459 1270 13 31
ENSDART00000140337 Nonsense 98 208 4 5
Genomic Location (Zv9):
Chromosome 5 (position 39931495)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37730885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCATGTGTGTGTAGGAGTATAAGCGTAAACAGCTGGAGGAGCAGAGA[C/T]AGTCAGAGAGGCTTCAGAGGCAGTTACAGCAGGAACATGCGTATCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236 Essential Splice Site 653 1287 None 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Essential Splice Site 649 1270 None 31
ENSDART00000140337   None 208 None 5
Genomic Location (Zv9):
Chromosome 5 (position 39924920)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37724310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCACGACTGATGCATGATTTTTCTATAATTCCTAATTTCTCTCTCTT[A/C]GATTCCTCAGAGAACAGCCTCTATAGCCACTGCACTGAACACAAATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236   926 1287 23 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Essential Splice Site 916 1270 None 31
ENSDART00000140337   None 208 None 5
Genomic Location (Zv9):
Chromosome 5 (position 39915693)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37715083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGTACCAGCCATCAGGGGGTAGTGGAGATAACATTTCTGTTGGAGG[T/C]AAAGTGGTTAGTTTGGGTACGGAGATTTTAAGGGGATTTTTAACACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236 Essential Splice Site 1031 1287 25 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Essential Splice Site 1015 1270 25 31
ENSDART00000140337   None 208 None 5
Genomic Location (Zv9):
Chromosome 5 (position 39912318)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37711708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCAGATGGATGTCCTGGAGGGACTGAACCTCCTCATCACTATATCAG[G/A]TTATAAAATGCTCTGTTCCTTATTTCACACACCCGTCTATCTTTGCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233   None 149 None 5
ENSDART00000051236 Nonsense 1191 1287 29 31
ENSDART00000082408   None 156 None 4
ENSDART00000135260 Nonsense 1174 1270 29 31
ENSDART00000140337   None 208 None 5
Genomic Location (Zv9):
Chromosome 5 (position 39910543)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37709933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCAGATGGGATGGAGATGCTGTTGTGTTATGAGGACGAAGGTGTTWA[T/A]GTCAACACGTACGGACGYATCATTAAAGATGTGGTGCTGCAGTGGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link