mink1

Ensembl ID:
ENSDARG00000035360
ZFIN ID:
ZDB-GENE-060526-45
Description:
misshapen-like kinase 1 [Source:RefSeq peptide;Acc:NP_001083048]
Human Orthologue:
MINK1
Human Description:
misshapen-like kinase 1 [Source:HGNC Symbol;Acc:17565]
Mouse Orthologue:
Mink1
Mouse Description:
misshapen-like kinase 1 (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1355329]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20489 Nonsense Mutation detected in F1 DNA During 2014
sa20488 Nonsense Mutation detected in F1 DNA During 2014
sa20487 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233 None None 149 None 5
ENSDART00000051236 Nonsense 451 1287 14 31
ENSDART00000082408 None None 156 None 4
ENSDART00000135260 Nonsense 449 1270 13 31
ENSDART00000140337 Nonsense 88 208 4 5
Genomic Location:
Chromosome 5 (position 39931523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTGCTTAATGACTTATTAATTGTTTGTTCATGTGTGTGTAGGAGTA[T/G]AAGCGTAAACAGCTGGAGGAGCAGAGACAGTCAGAGAGGCTTCAGAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233 None None 149 None 5
ENSDART00000051236 Nonsense 461 1287 14 31
ENSDART00000082408 None None 156 None 4
ENSDART00000135260 Nonsense 459 1270 13 31
ENSDART00000140337 Nonsense 98 208 4 5
Genomic Location:
Chromosome 5 (position 39931495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCATGTGTGTGTAGGAGTATAAGCGTAAACAGCTGGAGGAGCAGAGA[C/T]AGTCAGAGAGGCTTCAGAGGCAGTTACAGCAGGAACATGCGTATCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233 None None 149 None 5
ENSDART00000051236 None 926 1287 23 31
ENSDART00000082408 None None 156 None 4
ENSDART00000135260 Essential Splice Site 916 1270 None 31
ENSDART00000140337 None None 208 None 5
Genomic Location:
Chromosome 5 (position 39915693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGTACCAGCCATCAGGGGGTAGTGGAGATAACATTTCTGTTGGAGG[T/C]AAAGTGGTTAGTTTGGGTACGGAGATTTTAAGGGGATTTTTAACACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051233 None None 149 None 5
ENSDART00000051236 Nonsense 1191 1287 29 31
ENSDART00000082408 None None 156 None 4
ENSDART00000135260 Nonsense 1174 1270 29 31
ENSDART00000140337 None None 208 None 5
Genomic Location:
Chromosome 5 (position 39910543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCAGATGGGATGGAGATGCTGTTGTGTTATGAGGACGAAGGTGTTWA[T/A]GTCAACACGTACGGACGYATCATTAAAGATGTGGTGCTGCAGTGGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9we0s8nu