TRIM65 (15 of 82)

Ensembl ID:
ENSDARG00000035339
Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18809 Nonsense Mutation detected in F1 DNA During 2014
sa5310 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097712 Nonsense 52 524 2 9
ENSDART00000097712 Nonsense 52 524 2 9
Genomic Location:
Chromosome 5 (position 38647176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTGCATTAAGATCTACTGGGACCATTCTGACCACCTCGGCGTGTA[C/A]AGTTGTCCGCAGTGCCAGACCACCTTCACTCCTCGTCCCATCCTCAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097712 Nonsense 52 524 2 9
ENSDART00000097712 Nonsense 52 524 2 9
Genomic Location:
Chromosome 5 (position 38647176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGTGCATTAAGATCTACTGGGACCATTCTGACCACCTCGGCGTGTA[C/A]AGTTGTCCGCAGTGCCAGACCACCTTCACTCCTCGTCCCATCCTCAGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kuskbxzc