taf1

Ensembl ID:
ENSDARG00000035330
ZFIN ID:
ZDB-GENE-030131-5576
Description:
transcription initiation factor TFIID subunit 1 [Source:RefSeq peptide;Acc:NP_001038250]
Human Orthologues:
TAF1, TAF1L
Human Descriptions:
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like [Source:HGNC S
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf1
Mouse Description:
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20476 Nonsense Mutation detected in F1 DNA During 2016
sa10523 Essential Splice Site Available for shipment Available now
sa40499 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20475 Nonsense Mutation detected in F1 DNA During 2016
sa40498 Nonsense Mutation detected in F1 DNA During 2016
sa33651 Nonsense Mutation detected in F1 DNA During 2016
sa40497 Nonsense Mutation detected in F1 DNA During 2016
sa1937 Essential Splice Site Available for shipment Available now
sa40496 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15367 Nonsense Available for shipment Available now
sa26522 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40495 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 52 1947 3 40
ENSDART00000123402 Nonsense 52 587 3 13
ENSDART00000126927 Nonsense 52 369 3 10
ENSDART00000130225 Nonsense 52 1910 2 43
Genomic Location (Zv9):
Chromosome 5 (position 38189781)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35989465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCTCAGGAGTCAAAGAAGCATTTGGCTGGTCTGGGAACGCTGGGTT[T/A]GGGTTCACTCATTACAGAGATCACAGCCAGCGAGGAGGAAACAGCCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 793 1947 16 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 785 1910 16 43
Genomic Location (Zv9):
Chromosome 5 (position 38183117)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35982801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAYTTCACCATTCCTTGGATCATTGCACCCTGGACAGCTGCTACAGG[T/C]AACAYACACAGTTGCACAGTTCTGTCATCCTCTATTTTAAGATCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 978 1947 20 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 970 1910 20 43
Genomic Location (Zv9):
Chromosome 5 (position 38178360)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35978044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGAGGAAGAGAATGAGGAGGAATTCCAGATGAAGATTGACGATGAGG[T/G]CAGAGAATGAGGAGTACATTTGAATACTGTATTTGTGCAGTTTTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1088 1947 23 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Nonsense 1080 1910 23 43
Genomic Location (Zv9):
Chromosome 5 (position 38177690)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35977374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTCCCGTTGGGAGGTTATCGATGTCGTGAGGACCATGTCTACTGAG[C/T]AGGCTCGTTCAGGGGAAGGACCAATGAGTAAATTTGCTCGTGGGTCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1234 1947 25 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Nonsense 1214 1910 26 43
Genomic Location (Zv9):
Chromosome 5 (position 38168521)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35968205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCACTAGTCTGAACTCCTCAGCAACAGGGCGAAGGCTGAAAATCTA[T/A]CGCACCTTTTGTGATGAGGATGGCAAGGAGTATGTGCGCTGCGAGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1350 1947 27 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Nonsense 1330 1910 28 43
Genomic Location (Zv9):
Chromosome 5 (position 38167903)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35967587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGCAATTGGCCATATGAGAACCAACAAGTTTTGCCCGCTGTACTAC[C/T]AAACCAATGCTCCCCCCTCCAATCCGGTGGCTATGACAGAGGAACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1508 1947 30 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Nonsense 1488 1910 31 43
Genomic Location (Zv9):
Chromosome 5 (position 38165575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35965259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTTGCAGACGTTACGTGAAAACGTTCGCAAGCGCATGTACCCTTCA[C/T]GAGAGGAGTTCAGAGAAAGCGTTGAGCTCATCTTCAAAAACAGTGCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
Genomic Location (Zv9):
Chromosome 5 (position 38163536)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35963220
KASP Assay ID:
554-1925.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTATAAAGTCATCATCAACCCCATGGATCTGGACACACTCCGTAAGG[T/G]CAGGAAGATCTGTGTGTGGACACAGTAAACTTCAGTTGTAGTTTAGGTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
Genomic Location (Zv9):
Chromosome 5 (position 38163536)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35963220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTATAAAGTCATCATCAACCCCATGGATCTGGACACACTCCGTAAGG[T/C]CAGGAAGATCTGTGTGTGGACACAGTAAACTTCAGTTGTAGTTTAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1668 1947 35 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Nonsense 1648 1910 36 43
Genomic Location (Zv9):
Chromosome 5 (position 38163215)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35962899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATAGTCCTTATACAAAAACTGCTCTGGAAATTGTGAAMGTTTGCAAG[C/T]AGACTTTAGCGGAGGTGAGTCTGTGTGAGAGTCAGAGCTCTTTGTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196   None 1947 None 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Essential Splice Site 1724 1910 39 43
Genomic Location (Zv9):
Chromosome 5 (position 38160570)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35960254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACACAAACCCTTAGTCCAAGGTTCTTTATTAAGAGGATCCTCAGTT[A/G]CTTTTTTCACGTGTTATTGTATGATTTAATTAATTATAATTTTTTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1810 1947 38 40
ENSDART00000123402   None 587 None 13
ENSDART00000126927   None 369 None 10
ENSDART00000130225 Nonsense 1790 1910 40 43
Genomic Location (Zv9):
Chromosome 5 (position 38158441)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35958125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTACCAGGATCTGCTGATGTCAGATGCTGAAGATGATGCCAGTGAG[G/T]AGGAAGGCGATAATCCATTCTCCTGTAAGTGTATGCTTGAGTATTTGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link