taf1

Ensembl ID:
ENSDARG00000035330
ZFIN ID:
ZDB-GENE-030131-5576
Description:
transcription initiation factor TFIID subunit 1 [Source:RefSeq peptide;Acc:NP_001038250]
Human Orthologues:
TAF1, TAF1L
Human Descriptions:
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like [Source:HGNC S
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf1
Mouse Description:
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20476 Nonsense Mutation detected in F1 DNA During 2014
sa10523 Essential Splice Site Available for shipment Available now
sa2272 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20475 Nonsense Mutation detected in F1 DNA During 2014
sa1937 Essential Splice Site Available for shipment Available now
sa15367 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 52 1947 3 40
ENSDART00000123402 Nonsense 52 587 3 13
ENSDART00000126927 Nonsense 52 369 3 10
ENSDART00000130225 Nonsense 52 1910 2 43
Genomic Location:
Chromosome 5 (position 38189781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCTCAGGAGTCAAAGAAGCATTTGGCTGGTCTGGGAACGCTGGGTT[T/A]GGGTTCACTCATTACAGAGATCACAGCCAGCGAGGAGGAAACAGCCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 793 1947 16 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 785 1910 16 43
Genomic Location:
Chromosome 5 (position 38183117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAYTTCACCATTCCTTGGATCATTGCACCCTGGACAGCTGCTACAGG[T/C]AACAYACACAGTTGCACAGTTCTGTCATCCTCTATTTTAAGATCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1068 1947 22 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1060 1910 22 43
Genomic Location:
Chromosome 5 (position 38177893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAATGCCAAGCAGTTGCTTCGCAAGTTTGGGGTTCCTGAAGAAGAGG[T/C]GAGACTAACCCAACAAACTAATMRAAGATACAAGATCATAGATATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1088 1947 23 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1080 1910 23 43
Genomic Location:
Chromosome 5 (position 38177690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTCCCGTTGGGAGGTTATCGATGTCGTGAGGACCATGTCTACTGAG[C/T]AGGCTCGTTCAGGGGAAGGACCAATGAGTAAATTTGCTCGTGGGTCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
Genomic Location:
Chromosome 5 (position 38163536)
KASP Assay ID:
554-1925.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTATAAAGTCATCATCAACCCCATGGATCTGGACACACTCCGTAAGG[T/G]CAGGAAGATCTGTGTGTGGACACAGTAAACTTCAGTTGTAGTTTAGGTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1668 1947 35 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1648 1910 36 43
Genomic Location:
Chromosome 5 (position 38163215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATAGTCCTTATACAAAAACTGCTCTGGAAATTGTGAAMGTTTGCAAG[C/T]AGACTTTAGCGGAGGTGAGTCTGTGTGAGAGTCAGAGCTCTTTGTTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eahgt2a4