capns1a

Ensembl ID:
ENSDARG00000035329
ZFIN ID:
ZDB-GENE-030113-3
Description:
calpain, small subunit 1 a [Source:RefSeq peptide;Acc:NP_001017899]
Human Orthologue:
CAPNS1
Human Description:
calpain, small subunit 1 [Source:HGNC Symbol;Acc:1481]
Mouse Orthologues:
Capns1, Capns2
Mouse Descriptions:
calpain, small subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88266]
calpain, small subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1916793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6992 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015240 None None 216 None 10
ENSDART00000125653 None None 156 None 7
ENSDART00000131339 Essential Splice Site None 216 None 11

The following transcripts of ENSDARG00000035329 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 38255123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGTACGTCGGCTGACGACGGTTTACAGTATCCACTGCTCTTTACTGG[T/A]GAGTTTAATCTGTCTGCGTGTTAAACAACGAGTTGAAAAGATATTTACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8cbaws50