ckma

Ensembl ID:
ENSDARG00000035327
ZFIN ID:
ZDB-GENE-980526-109
Description:
muscle creatine kinase a [Source:RefSeq peptide;Acc:NP_571007]
Human Orthologue:
CKM
Human Description:
creatine kinase, muscle [Source:HGNC Symbol;Acc:1994]
Mouse Orthologue:
Ckm
Mouse Description:
creatine kinase, muscle Gene [Source:MGI Symbol;Acc:MGI:88413]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7571 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032481 Missense 335 381 8 8
Genomic Location:
Chromosome 5 (position 38432705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGATTTCTCTCAGGKGGTGTGGACACYGCCTCCGTTGGTGGAGTGTTTG[A/G]CATTTCCAACGCTGACCGTATCGGCTCTTCAGAGGTTGWGCAGGTGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fktu9vzs