nccrp1

Ensembl ID:
ENSDARG00000035326
ZFIN ID:
ZDB-GENE-000210-13
Description:
nonspecific cytotoxic cell receptor protein 1 [Source:RefSeq peptide;Acc:NP_570996]
Human Orthologue:
NCCRP1
Human Description:
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish) [Source:HGNC Symbol;Acc:33739]
Mouse Orthologue:
Nccrp1
Mouse Description:
non-specific cytotoxic cell receptor protein 1 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33652 Nonsense Mutation detected in F1 DNA During 2017
sa2198 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa33652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051186 Nonsense 83 237 3 6
Genomic Location (Zv9):
Chromosome 5 (position 38452962)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36252646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTATCCTGTTCTGTGATGCTAAATGTAGGTAATTTCTCTGGCTG[G/A]AAAACTAATACAGAAGTTTTGCCCTATGACACTAGTGGAATTCCTCCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2198
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051186 Nonsense 128 237 4 6
Genomic Location (Zv9):
Chromosome 5 (position 38453458)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36253142
KASP Assay ID:
554-2492.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCACTCTAGAGCAGTGTGTGGACCTGAAGGCAGCAGGTCTGTGGGAC[C/T]AACTGCTGGACGACTTTCAGCCAGAGATTGTCATTGAAGACTGGTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link