entpd3

Ensembl ID:
ENSDARG00000035309
ZFIN ID:
ZDB-GENE-030131-6186
Description:
ectonucleoside triphosphate diphosphohydrolase 3 [Source:RefSeq peptide;Acc:NP_001077050]
Human Orthologue:
ENTPD3
Human Description:
ectonucleoside triphosphate diphosphohydrolase 3 [Source:HGNC Symbol;Acc:3365]
Mouse Orthologue:
Entpd3
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 3 Gene [Source:MGI Symbol;Acc:MGI:1321386]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22753 Essential Splice Site Available for shipment Available now
sa10474 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104151 Essential Splice Site 207 518 6 10
ENSDART00000129068 Essential Splice Site 186 497 6 10
Genomic Location:
Chromosome 16 (position 9568609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGAGCTTAACTGAACTTTTACAATTTTAAACTTTAATCTGTTTTCT[A/T]GAAAAATCTTTGGAATGCCTGGGTACATCCTCATGGGGCTAAGACAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104151 Nonsense 338 518 7 10
ENSDART00000129068 Nonsense 317 497 7 10
Genomic Location:
Chromosome 16 (position 9566214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGAYCCAAARCGTTYAATTACTTTCTTTGGACAGAGCAACCCTGAA[C/T]AGTGCAAAGCCTTGGTCAGGAGTATCTTTGACCTCACATCCTGCCAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pvkqsgk7