si:ch211-149m3.3

Ensembl ID:
ENSDARG00000035308
ZFIN IDs:
ZDB-GENE-091020-12, ZDB-GENE-100921-32
Human Orthologue:
GRB10
Human Description:
growth factor receptor-bound protein 10 [Source:HGNC Symbol;Acc:4564]
Mouse Orthologue:
Grb10
Mouse Description:
growth factor receptor bound protein 10 Gene [Source:MGI Symbol;Acc:MGI:103232]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19132 Nonsense Mutation detected in F1 DNA During 2017
sa22755 Nonsense Available for shipment Available now
sa18384 Nonsense Available for shipment Available now
sa42661 Nonsense Mutation detected in F1 DNA During 2017
sa22754 Nonsense Available for shipment Available now
sa36043 Nonsense Mutation detected in F1 DNA During 2017
sa17433 Nonsense Available for shipment Available now
sa42660 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 9 594 1 16
ENSDART00000137365   None 578 None 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9780100)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8566039
KASP Assay ID:
2260-9220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACACTAACAGAACGTGTATCATGGCTGTGGCCGGATGTCCGGATTA[T/A]TTTCTACACCATCCAAATTACAAGGTAGAAATTATTTTAATTTTTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 191 594 5 16
ENSDART00000137365 Nonsense 176 578 4 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9694813)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8480752
KASP Assay ID:
2260-9219.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGAAAGGTGGTGGAGATCCCAGCCGACATGACGGCGCGAGACCTGTG[C/A]CAGTTTCTCGTCTATAAAAACCATTGTGTGGACGATAACAGTTGGGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 192 594 5 16
ENSDART00000137365 Nonsense 177 578 4 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9694812)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8480751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAAAGGTGGTGGAGATCCCAGCCGACATGACGGCGCGAGACCTGTGC[C/T]AGTTTCTCGTCTATAAAAACCATTGTGTGGACGAYAACAGYTGGGCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 284 594 8 16
ENSDART00000137365 Nonsense 269 578 7 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9679544)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8465483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATCTGTGTGTTTTATTGAATCCATCTTCTTTCATCACCAGAACTTCT[T/A]GAACTCCAGCAGTTGTCCTGAGATCCAGGGATATTTGTATGTGAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 310 594 8 16
ENSDART00000137365 Nonsense 295 578 7 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9679465)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8465404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATATTTGTATGTGAAAGAGATGGGCAGGAAATCGTGGAAGAAACTGTA[T/A]GTGTTTTTAAGACGGTCAGGGTTGTATTTTTCGACGAAAGGAACGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 319 594 8 16
ENSDART00000137365 Nonsense 304 578 7 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9679438)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8465377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAATCGTGGAAGAAACTGTATGTGTTTTTAAGACGGTCAGGGTTGTA[T/A]TTTTCGACGAAAGGAACGTCAAAGGTAAGTTAACTTCTATAAAAGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 461 594 12 16
ENSDART00000137365 Nonsense 446 578 11 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9672764)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8458703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAATCCTKTGGAGGCACAGAGTGCTGCCATGGAGGAGGGACATGCCT[G/A]GAGAGTGAGTTACAATAATATTTTTTGGTCATTTAARTTACATGTTARAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 462 594 12 16
ENSDART00000137365 Nonsense 447 578 11 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9672762)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8458701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATCCTGTGGAGGCACAGAGTGCTGCCATGGAGGAGGGACATGCCTGG[A/T]GAGTGAGTTACAATAATATTTTTTGGTCATTTAAGTTACATGTTAAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link