ncor1

Ensembl ID:
ENSDARG00000035285
ZFIN ID:
ZDB-GENE-040426-993
Description:
nuclear receptor corepressor 1 [Source:RefSeq peptide;Acc:NP_956570]
Human Orthologues:
AC144838.1, AL391119.1, NCOR1
Human Descriptions:
nuclear receptor corepressor 1 [Source:HGNC Symbol;Acc:7672]
Putative nuclear receptor corepressor 1-like protein C20orf191 [Source:UniProtKB/Swiss-Prot;Acc:Q9H4
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NGY8]
Mouse Orthologue:
Ncor1
Mouse Description:
nuclear receptor co-repressor 1 Gene [Source:MGI Symbol;Acc:MGI:1349717]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18033 Nonsense Available for shipment Available now
sa38496 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38495 Nonsense Mutation detected in F1 DNA During 2017
sa40531 Nonsense Mutation detected in F1 DNA During 2017
sa17067 Nonsense Available for shipment Available now
sa40530 Nonsense Mutation detected in F1 DNA During 2017
sa20512 Essential Splice Site Available for shipment Available now
sa13384 Nonsense Available for shipment Available now
sa13203 Nonsense Available for shipment Available now
sa38494 Nonsense Mutation detected in F1 DNA During 2017
sa17231 Nonsense Available for shipment Available now
sa2211 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa18033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 492 2409 15 48
ENSDART00000143573 Nonsense 454 2398 14 47
Genomic Location (Zv9):
Chromosome 5 (position 43553265)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41334530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTCAKCTGTCTAAATGCTTCTGGTATTGTGCTTCTTTTCTTKAAAAG[C/T]AGATAACACGACCTTCACAGGAAGAGAAGACAGAAGACAAGAACGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Essential Splice Site 653 2409 18 48
ENSDART00000143573 Essential Splice Site 615 2398 17 47
Genomic Location (Zv9):
Chromosome 5 (position 43545973)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41327238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAGACGTCTCGCTGGACGGAGGAGGAGATGGAGATCGCCAAAAAAGG[T/C]ACTGCTTGACTTTTACTTCATTTCCCGAACTCCCCATCCCCCCTCCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 759 2409 21 48
ENSDART00000143573 Nonsense 721 2398 20 47
Genomic Location (Zv9):
Chromosome 5 (position 43536192)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41317457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACCCTCAGAATCACTAACTCATACCAGTTCAGCAGTGGATGGCGGAT[C/A]AGACCAGGACGTCACTGCAGCCAAAGGCCCGGTGGCAGATGCCAAAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 804 2409 21 48
ENSDART00000143573 Nonsense 766 2398 20 47
Genomic Location (Zv9):
Chromosome 5 (position 43536058)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41317323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAAGAGTCCAGAAGGAGGAGCCGGAGATGTGCTTCCTCAGGATGAT[C/T]GAGCACGCTCAGCTTATGAAATGCAGATCCATCCAAAGAGCGAGCCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 1071 2409 25 48
ENSDART00000143573 Nonsense 1060 2398 24 47
Genomic Location (Zv9):
Chromosome 5 (position 43522163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41303428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACAGGCCGCCAAACATTCCCTCTCCTCCACCCCTCATTCACACCTCC[A/T]AACCYACAGACAAGCCCTCCTTCATTCAAGGCGGCTCCATTTCGCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 1309 2409 31 48
ENSDART00000143573 Nonsense 1298 2398 30 47
Genomic Location (Zv9):
Chromosome 5 (position 43518937)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41300202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTCCACATGAGTCGAAGGATCGACCCATGCTTGCAGGATCCATAATG[C/T]AAGGTAATTTGTGGACCCATTTTGAAAATTCATATTGTATTTTTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Essential Splice Site 1310 2409 31 48
ENSDART00000143573 Essential Splice Site 1299 2398 30 47
Genomic Location (Zv9):
Chromosome 5 (position 43518932)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41300197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATGAGTCGAAGGATCGACCCATGCTTGCAGGATCCATAATGCAAGG[T/C]AATTTGTGGACCCATTTTGAAAATTCATATTGTATTTTTTTTAAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 1610 2409 35 48
ENSDART00000143573 Nonsense 1599 2398 34 47
Genomic Location (Zv9):
Chromosome 5 (position 43514973)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41296238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACCATGGARAACACTCGGCAAACCATCCTAAACGATTACATMACGTCA[C/T]AACAGATGCAGGTCATACCACGGCCTGATCTCGCAAGGGGACTATCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 1741 2409 38 48
ENSDART00000143573 Nonsense 1730 2398 37 47
Genomic Location (Zv9):
Chromosome 5 (position 43510034)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41291299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCYTCCAGCATTTTCAAGACATGACACTTTTYTCTTTCAGGTCCCGAG[C/T]AGCCTGTTCGACCAGGCAGCCGTAGTTTCCTGCGCTCCACCTCTCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 1795 2409 39 48
ENSDART00000143573 Nonsense 1784 2398 38 47
Genomic Location (Zv9):
Chromosome 5 (position 43508839)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41290104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTACTTCTGTTTGTCCAGGCCAATGCAGTCACAAGCAGCTGCAGCT[C/T]AAGCAAACTCCCGATACAACAACGCTGCTGATGCCCTCGCCGCCTTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Nonsense 2009 2409 41 48
ENSDART00000143573 Nonsense 1998 2398 40 47
Genomic Location (Zv9):
Chromosome 5 (position 43504372)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41285637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGCCCGGGGATTCAGGACCATCTGCACCCCAGCCGCCCCCCTCCTCA[C/T]AATCAGACAGTTATGGCTCTGTCCCWAAAACACACCGCATCATGACYCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2211
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097574 Essential Splice Site 2030 2409 41 48
ENSDART00000143573 Essential Splice Site 2019 2398 40 47
Genomic Location (Zv9):
Chromosome 5 (position 43504305)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41285570
KASP Assay ID:
554-2666.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTCCCWAAAACACACCGCATCATGACYCTCGCTGACCACATTTCGG[T/A]AAGACACACTCAAACTCCTGATGCTTTATCACAGATCCTGCTTCCTCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link