riok2

Ensembl ID:
ENSDARG00000035264
ZFIN ID:
ZDB-GENE-040426-2913
Description:
serine/threonine-protein kinase RIO2 [Source:RefSeq peptide;Acc:NP_998719]
Human Orthologue:
RIOK2
Human Description:
RIO kinase 2 (yeast) [Source:HGNC Symbol;Acc:18999]
Mouse Orthologue:
Riok2
Mouse Description:
RIO kinase 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914295]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13574 Nonsense Available for shipment Available now
sa1588 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa13574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051092 Nonsense 135 512 4 10

The following transcripts of ENSDARG00000035264 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43261724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTTTGCTCTGAAACTTCATAGACTGGGCAGGACGTCCTTCAGAAACT[T/A]GAAGAATAAGAGAGATTATCACAAGCACAGAAACAATATGTCATGGYTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1588
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051092 Essential Splice Site 260 512 6 10

The following transcripts of ENSDARG00000035264 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43260887)
KASP Assay ID:
554-1530.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCGACTTCCCTCAGATGGTCTCCACCTCACATATAAATGCAGAATGG[T/C]GAATATCTGTTCAGATATCAAACTGATTATTATTATTTAATAAAGAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dt48mv7y