riok2

Ensembl ID:
ENSDARG00000035264
ZFIN ID:
ZDB-GENE-040426-2913
Description:
serine/threonine-protein kinase RIO2 [Source:RefSeq peptide;Acc:NP_998719]
Human Orthologue:
RIOK2
Human Description:
RIO kinase 2 (yeast) [Source:HGNC Symbol;Acc:18999]
Mouse Orthologue:
Riok2
Mouse Description:
RIO kinase 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914295]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31468 Nonsense Mutation detected in F1 DNA During 2016
sa13574 Nonsense Available for shipment Available now
sa1588 Essential Splice Site F2 line generated During 2016
sa33677 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051092 Nonsense 14 512 1 10

The following transcripts of ENSDARG00000035264 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43263509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGCCACTATGGGCAAATTAAACGTGGTAATCCTGAGGTATCTGTCT[A/T]GAGATGATTTTAGAGTGCTGACAGCGGTACGTATCCATTTCATAAAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051092 Nonsense 135 512 4 10

The following transcripts of ENSDARG00000035264 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43261724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTTTGCTCTGAAACTTCATAGACTGGGCAGGACGTCCTTCAGAAACT[T/A]GAAGAATAAGAGAGATTATCACAAGCACAGAAACAATATGTCATGGYTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1588
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051092 Essential Splice Site 260 512 6 10

The following transcripts of ENSDARG00000035264 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43260887)
KASP Assay ID:
554-1530.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCGACTTCCCTCAGATGGTCTCCACCTCACATATAAATGCAGAATGG[T/C]GAATATCTGTTCAGATATCAAACTGATTATTATTATTTAATAAAGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051092 Nonsense 284 512 7 10

The following transcripts of ENSDARG00000035264 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 43260728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTCGAGATTTCTTCATAAAAAGATTTAACTATGAAAGCGAACTCTA[T/A]CCAACCTTCAAAGATATCAGGTAATGTTTTTTTCTTTCAGAATGCTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link