npr3

Ensembl ID:
ENSDARG00000035253
ZFIN ID:
ZDB-GENE-060531-91
Description:
atrial natriuretic peptide receptor 3 [Source:RefSeq peptide;Acc:NP_001096143]
Human Orthologue:
NPR3
Human Description:
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) [Source:HGN
Mouse Orthologue:
Npr3
Mouse Description:
natriuretic peptide receptor 3 Gene [Source:MGI Symbol;Acc:MGI:97373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6997 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074796 Nonsense 38 472 1 8
ENSDART00000143446 Nonsense 68 502 1 8
Genomic Location (Zv9):
Chromosome 5 (position 42925601)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40706866
KASP Assay ID:
554-4889.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGTACGCGAAAAAAGCCCTCAGAGAAGCAGACGCGTATGCGGGACTG[A/T]GATTCAATGTGCGCTTTGAGAACTCCGCGTGCGGGATGGACGCTCTCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
  • Blood pressure: Meta-analysis of genome-wide association studies identifies common variants associated with blood pressure variation in east Asians. (View Study)
  • Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • Ovarian reserve: Genetic variants and environmental factors associated with hormonal markers of ovarian reserve in Caucasian and African American women. (View Study)
  • Systolic blood pressure: Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link