LOC100331554

Ensembl ID:
ENSDARG00000035227
Human Orthologue:
SLC37A3
Human Description:
solute carrier family 37 (glycerol-3-phosphate transporter), member 3 [Source:HGNC Symbol;Acc:20651]
Mouse Orthologue:
Slc37a3
Mouse Description:
solute carrier family 37 (glycerol-3-phosphate transporter), member 3 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44430 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097192 Essential Splice Site 349 501 10 15
Genomic Location (Zv9):
Chromosome Zv9_NA915 (position 44421)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149790.1 44421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAAGCCGACCGGCTGTCCGTGTGGTATGACGTTGGAGGAATTATCGG[T/C]GAGTGTTCGGTTTGATCCATTTCCAGTCAAGTCTGAACTTTTTTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link